This allele from project Map3k20-8667J-4407M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAGCACCAAAGAAAAGTA, CATGACGCCATACTTTTCTT, TGCAGAGCCTGACCAGCGCG and TTGTAGGACAGATTAGCTCG, which resulted in a 609 bp deletion beginning at Chromosome 2 positive strand position 72,371,660 bp CTTTTCTTTGGTGCTAAGGT, and ending after CCTGACCAGCGCGAGGCCTG at 72,372,268 bp (GRCm38/mm10). This mutation deletes exons 6 and 7 and 442 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 12 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count