Styxl1^em1(IMPC)J

This allele from project Styxl1-8615J-6464M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAGGGAGTAAGTATCCACC, CGCAGAGAGCAGATGCACGG, ACTCAGAACTGGACACGTGA and ACATGAGAACACTGGTGGGC, which resulted in a 333 bp deletion beginning at Chromosome 5 negative strand position 135,768,952 bp, CGTGTCCAGTTCTGAGTTCA, and ending after AAGGTCCATACAGCCCCCG at 135,768,620 bp (GRCm38/mm10). This mutation deletes exon 3 and 271 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 55 amino acids later. (J:188991)