Rxylt1^em1(IMPC)J

This allele from project Tmem5-8633J-5241F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTATATAACTGCTAGA, GTATTTTTCCCAAGCTGAAG, TATGGCAGTTAACTGTACGA and AGAATACTGTATTTACACCG, which resulted in a 382 bp deletion beginning at Chromosome 10 negative strand position 122,094,873 bp, CGTACAGTTAACTGCCATAT, and ending after GTCATTTCCCCTTCAGCTTG at 122,094,492 bp (GRCm38/mm10). This mutation deletes exon 3 and 279 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (TTCCTCGGTGTAAA) 64 bp before the 382 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 109 and early truncation 7 amino acids later. (J:188991)