This allele from project Rab8a-8582J-1846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGCGACAACAGTAGCTGAA, CTAAAGCCTTCTACAGGCTG, CCAGTGTAGAGTCCAGCGAA and CACGATTCAGGGCCCAAACA, which resulted in a 233 bp deletion beginning at Chromosome 8 positive strand position 72,168,281 bp, CTTCAGCTACTGTTGTCGCC, and ending after GCTAGTGCCTTGTTTGGGCC at 72,168,513 bp (GRCm38/mm10). This mutation deletes exon 2 and 172 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (G) 18 bp after the exon deletion, that will not affect the results of the exon deletion. This allele is predicted to cause a change of amino acid sequence after residue 42 and early truncation 54 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count