Tldc2^em1(IMPC)J

This allele from project Tldc2-8630J-5356M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGTGGCAGAGGGCATAAG, CAGTGTTGTGTAGGGACTGG, GGCCCATGGCCCTTTCCCAA and GTGTGACGTGACTGGGAACG, which resulted in a 470 bp deletion beginning at Chromosome 2 positive strand position 157,095,100 bp, GATCTGTGGCAGAGGGCATA, and ending after GTGACGTGACTGGGAACGAG at 157,095,569 bp (GRCm38/mm10). This mutation deletes exon 5 and 396 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early truncation 24 amino acids later. (J:188991)