Tmem171^em1(IMPC)J

This allele from project Tmem171-8631J-5335M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATCAAAGCTCACAGAGCAG, GCTGAGTGTGAGCAGCGAGG, GAAACACCCTTGAGTGCGCG and ACTTGACATGGAACTGTCGC, which resulted in a 359 bp deletion beginning at Chromosome 13 negative strand position 98,688,580 bp, ACTCAAGGGTGTTTCGGCCT, and ending after TGTTTGAGATCCCGCCTCGC at 98,688,222 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp (CTGTCG) intronic deletion 25 bp before the 359 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 213 and early truncation 86 amino acids later. (J:188991)