Sdhaf2^em1(IMPC)J

This allele from project Sdhaf2-8595J-8861M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAAGATGCAGCTCAGCATA, GATATGACTTTAGACTCTAA, ATAAAGGGACCAAAATCCGC and ACAGTAACCATTGTCTAACG, which resulted in a 570 bp deletion beginning at Chromosome 19 negative strand position 10517492 bp CGCAGGACTAAGTGAGATCT, and ending after ATAACAAGCCCATTAGAGTC at 10516923 bp (GRCm38/mm10). This mutation deletes exons 2 and 3 and 242 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. (J:188991)