Rab13^em1(IMPC)J

This allele from project Rab13-8581J-8563M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGTGGAAAGTATGGTGG, ACCTGAGTACCAGCAGTTAC, GGGTCAAAGGGCAATCTGGC and GGGCAATCTGGCTGGGGACT, which resulted in a 164 bp deletion beginning at Chromosome 3 positive strand position 90,222,162 bp, TTACTGGTGCAGCCCCCACT, and ending after GCTGCCCAGTCCCCAGCCAG at 90,222,325 bp (GRCm38/mm10). This mutation deletes exon 2 and 103 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later. (J:188991)