Tat^em1(IMPC)J

This allele from project Tat-8619J-6295M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATGAACTGCCCTTAAGCAA, GGGGCACGACTGTCAATCAA, TCTTTGCTTCTGCCCCACAT and AGAGTCTCGAAGGACCCCCA, which resulted in a 412 bp deletion beginning at Chromosome 8 positive strand position 109,992,483 bp, GCAAGGGTAGAGGGTGGCTG, and ending after GAGTCTCGAAGGACCCCCAA at 109,992,894 bp (GRCm38/mm10). This mutation deletes exon 4 and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 11 amino acids later. (J:188991)