Rasgef1a^em1(IMPC)J

This allele from project Rasgef1a-8583J-1847M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCGACTAGGCTTACAGCA, CTGCTGCTCTTAGTCCCAGA, TGACAGATCTGGTCCTCCCT and TGCCTGCTCAGAGGAGCCTG, which resulted in a 836 bp deletion beginning at Chromosome 6 positive strand position 118,088,863 bp, GAGAGACACAGGCCCTGCTG, and ending after ACAGATCTGGTCCTCCCTAG at 118,089,698 bp (GRCm38/mm10). This mutation deletes exons 11-12 and 639 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 408 and early truncation 4 amino acids later. (J:188991)