Plod2^em1(IMPC)J

This allele from project Plod2-8544J-3803F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTTGTGTAACTAATCAG, GCTGTTTCTCCATAACATTA, GTTGAAAACATGATGGGACG and ATGACCCTCCAAAGGAAGTC, which resulted in a 390 bp deletion beginning at Chromosome 9 positive strand position 92,571,193 bp, CATAATGTTATGGAGAAACA, and ending after AAAACATGATGGGACGGGGC at 92,571,582 bp (GRCm38/mm10). This mutation deletes exon 2 and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 11 amino acids later. (J:188991)