Using CRISPR/Cas9 genome engineering, Cybb is targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. The mutation is identified as a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter. (J:241420)
Basic Information
NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count