Dhrs11^em1(IMPC)J

This allele from project Dhrs11-8573J-5846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGAGAGATCCCTATCGGA, AGAGGGATTTAGTATCCAAA, GAGCAGGTGTTAGAGCCGTG and ACTGGTTTCCTGAGGGAGAG, which resulted in a 286 bp deletion beginning at Chromosome 11 negative strand position 84,823,227 bp, CTCTAACACCTGCTCACTGG, and ending after GGGATTTAGTATCCAAACGG at 84,822,942 bp (GRCm38/mm10). This mutation deletes exon 3 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 15 amino acids later. (J:188991)