This allele from project Alpk2-8569J-1734M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCAAACATGAGCACACCA, AGGTAATCCATTCATACAGA, GGTCAGTTGAAGTTATAAAT and ATCCCATTGTGCTCATCAAT, which resulted in a 493 bp deletion beginning at Chromosome 18 negative strand position 65,372,964 bp, TCAATAGGCCTTCTTATTAA, and ending after CTCCCTAGACAGTATAGCAC at 65,372,472 bp (GRCm38/mm10). In addition there is a 28 bp insertion, ATTGTAAAAGGGTCAGTTGAAGTTATTA, apparently from nearby Chr:18 65,372,889-65,372,916, into the deletion site that is not predicted to alter the results of the exon deletion. This mutation deletes exon 3 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 19 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count