Kash5^em1(IMPC)J

This allele from project Ccdc155-8506J-0155M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTCCCAAGCCAACCACA, GCATCTAAAAGGACACGGAG, CAGACACTGTTCTTAAACCG and CTCTGGCCTGGTTACAGCAG, which resulted in a 424 bp deletion beginning at Chromosome 7 negative strand position 45,196,244 bp, AACCTGCTGATGACAGACAC, and ending after CACGGAGGGGTGAAGGGGTC at 45,195,821 bp (GRCm38/mm10). In addition there is an intronic 17 bp deletion 101 bp before the 424 bp deletion, that will not alter the result of the exon deletion. This mutation deletes exon 4 and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 1 amino acid later. (J:188991)