Polr1c^em1(IMPC)J

This allele from project Polr1c-8545J-8326M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTACATCTGCCTTCGCCT, CCTACTGCTGGGGCTTTAGT, ACCACCCTACCTGCCCCAGA and GGTTCACACCTATGACAGTC, which resulted in a 535 bp deletion beginning at Chromosome 17 negative strand position 46,246,036 bp, CTGGGGCAGGTAGGGTGGTT, and ending after TCTTGTACATCTGCCTTCGC at 46,245,502 bp (GRCm38/mm10). This mutation deletes exon 4 and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 7 amino acids later. (J:188991)