Apol8^em1(IMPC)J

This allele from project Apol8-8505J-5445F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAAGCTGAGAGCCATCGGA, ACTGGGTGAGGAAGACACGG, TGGTCCCACCTAAGGAGGCG and TCCCAACACCAGCTCTCCAG, which resulted in a 522 bp deletion beginning at Chromosome 15 negative strand position 77,753,103 bp, GCTCTCCAGGGGTGGGTGTC, and ending after AAGCTGAGAGCCATCGGAAG at 77,752,582 bp (GRCm38/mm10). This mutation deletes exon 3 and 395 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 42 amino acids later. (J:188991)