This allele from project B3galnt2-7842J-F8897 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGGCCTAACAAAAGGAGA, CTCAGTAGTTAGCAGCCCTT, TAAATTCGTTGTCAAGTAAA and CAGACTTATTAGACTTATTA, which resulted in a two-part deletion of 379 bp in total. This deletion begins at Chromosome 13 positive strand position 13,970,629 bp deletes 29 bp CCCTTGGGTTTCATGCCCTCTCCTTTTGT, then retains 3 endogenous bp (TAG) in the intron, then removes 350 bp and ends after TGACAGACTTATTAGACTTA at 13,971,010 bp (GRCm38/mm10). This mutation deletes exon 3 and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count