This allele from project Agbl1-8255J-F6210 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTCCATGATGAATCTGGA, ACAGTGCTCTTGCTTAATAA, TCCAGACATCACTATCGTTG and ATGAATATTATTGCAACCAA, which resulted in a two part deletion of 266 bp in total. This deletion begins at Chromosome 7 positive strand position 76,414,540 bp, deletes 17 bp, CTTAATAATGGGTCCCT, then retains 4 endogenous bp (CATT) of the intron, then removes 249 bp ending after TGAACTTACCCCAACGATAG at 76,414,809 bp (GRCm38/mm10). This mutation deletes exon 9 and 201 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 300 and early truncation 1 amino acid later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count