This allele from project Pxdn-8144J-M7082 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCCATAACAAGATCAAGG, GGAAGTTGATCTATCCAGGA, ATCCCCAGTTCACGTTGCAG and GTCACACTGGTCCTTCAGTA, which resulted in a 688 bp deletion beginning at Chromosome 12 positive strand position 29,984,151 bp CTTGATCTTGTTATGGCTGT, and ending after CACGTGAGCCTCACATTTTT at 29,984,838 bp (GRCm38/mm10). This mutation deletes exon 7 and 518 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 184 and early truncation 25 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count