Kynu^em1(IMPC)J

This allele from project Kynu-8351J-M627 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCATAACTTAAACCCACAG, CTTCCAATCACAAATAGCCA, CTTCTTTGCTGGACATTAAA and TGGAGTTACACCTTTTAACT, which resulted in a deletion of 340 bp in total. This deletion begins at Chromosome 2 positive strand position 43,581,141 bp, CCTCTGTGGGTTTAAGTTA, removes 19 bp, then retains 3 endogenous bases (TGC) in the intron, and then removes 321 bp, ending after GATGTAAGTACCAAGTTAAA at 43,581,483 bp (GRCm38/mm10). This mutation deletes exon 3 and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 7 amino acids later. (J:188991)