Ptprk^em1(IMPC)J

This allele from project Ptprk-8356J-M669 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAGAACATTGATAAGCCA, TCTTGACTGATATTTTTCTA, ACAAACCAGAAAAATCTCAG and TTCCCAACTCCTTCTTGAGG, which resulted in a 555 bp deletion beginning at Chromosome 10 positive strand position 28,263,339 bp, TTTTCTATGGCCCTGCCCCA, and ending after TGTTTCCCAACTCCTTCTTG at 28,263,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 2 amino acids later. (J:188991)