Tcn2^em1(IMPC)J

This allele from project Tcn2-8386J-M4720 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATCCAAGTTATAAGAGAT, TATAACTTGGATCAAGTCAC, ATAGAGGGCATTTCTCCTGG and ATAGTTGCTTGCTAGTGGCA, which resulted in a 646 bp deletion beginning at Chromosome 11 negative strand position 3,927,730 bp GCATTTCTCCTGGCGGGCTG, and ending after CAGGCTGGATTCTAATTGGG at 3,927,085 bp (GRCm38/mm10). This mutation deletes exon 3 and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 41 amino acids later. (J:188991)