Fbxo10^em1(IMPC)J

This allele from project Fbxo10- 8390J-M4753 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAATCTCCCGAGGAGCAGG, AGTGCCAGATAGTCTGGGCA, GTACCAAGACGGACACAGCC and GCTGTGTGCTCAGGAATGGC, which resulted in a 512 bp deletion beginning at Chromosome 4 positive strand position 45,048,176 bp, GGAGGCACATGGTTGCCTTT, and ending after AGGACAAAACACCACCAGCC at 45,048,687 bp (GRCm38/mm10). This mutation deletes exon 5 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 519 and early truncation 28 amino acids later. (J:188991)