This allele from project Bckhb-8188J-M1369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAATCCCAGGTATCTCAA, CAATACGCATCTGAAAATGA, GCAGTTCGCATTTTGTAGAG and TGAGGGTCTCCAGCTTTCCG, which resulted in a 528 bp deletion beginning at Chromosome 9 positive strand position 83,988,526 bp, TTGAGATACCTGGGATTTGC, and ending after GCAGTTCGCATTTTGTAGAG at 83,989,053 bp (GRCm38/mm10). This mutation deletes exon 4 and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 13 amino acids later. Western blot analysis confirmed the absence of the protein in the liver, heart and brain of homozygous mutant neonates. (J:188991, J:344897)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count