This allele from project Gm16314-8293J-M2383 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGGCAGAAAACCCTAA, GCTCAACCATCACCTCTGAC, GGTTAGACCTCAACCAAGCA and GTGCTCAGAAGCCCTAGCAT, which resulted in a 942 bp deletion beginning at Chromosome 16 positive strand position 18,500,884 bp, GTCAGAGGTGATGGTTGAGC, and ending after TCCCTCCAAACCCTGCTTG at 18,501,825 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the translation start and stop and is predicted to result in a null mutation. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count