This allele from project Chmp7-8200J-F4216 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATGTAAAAATAACCCA, GCTGATTACTTCCGGACAGT, GTTAATATAATGCCTCTGAG and TGCGACAGACAGCCTGTCCT, which resulted in a 385 bp deletion beginning at Chromosome 14 negative strand position 69,730,348 bp CAGGCTGTCTGTCGCATTAC, and ending after TAGGGTTATATATTCCTTGG at 69,729,964 bp (GRCm38/mm10). This mutation deletes exon 2 and 213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 25 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count