This allele from project Alg8-8256J-M6218 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGTCTCAGAGATATCCAA, TCTCAGGCAACCGCACGAAA, GCAGGCAGTTGCTCTACATG and CAGTTAACAGAGATCCACTT, which resulted in a 571 bp deletion beginning at Chromosome 7 negative strand position 97,373,999 bp CAGGCAGTTGCTCTACATGG, and ending after GTTCTCAGGCAACCGCACGA at 97,373,429 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion 19 bp after the deletion that will not affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence and early truncation after residue 31. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count