This allele from project Igf2bp3-8307J-M0642 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAACAATAACCCAGAAGCA, TGTGCTTCCTCCCTAAAAAG, ACACACAAGAGGCAAGACGA and AAAAGCCACACCCACCCGAA, which resulted in a 447 bp deletion beginning at Chromosome 6 negative strand position 49,213,510 bp CCGAAGGGTCAGCTCTGCAC, and ending after TTGCCTGCGGCCCCTGCTTC at 49,213,064 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 21 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count