Apmap^em1(IMPC)J

This allele from project Apmap-8259J-M2499 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACACAGCTCCCAGACAG, GTTGCCACTGTTGCTCAGGG, CCATACCGCAGACATCCTGA and AACTGTCTTGAGGCCATGGG, which resulted in a 434 bp deletion beginning at Chromosome 2 negative strand position 150,594,667 bp, GTGATGAGACCGTCAGGATG, and ending after TGCCACTGTTGCTCAGGGTG at 150,594,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 318 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 1 bp insertion 43 bases before the deletion that will not affect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 69 and early truncation 15 amino acids later. (J:188991)