Pdzrn3^em1(IMPC)J

This allele from project Pdzrn3-8311J-M0809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTAGTTAAGTAACCCGCA, AGGAGGCCGGAGATGCACCC, ACTTCCTCGGAAAATGCCCG and CCCTCCCTATGGCCAAAAGA, which resulted in a 1147 bp deletion beginning at Chromosome 6 negative strand position 101,378,125 bp AAAGAGGGTCGTGAGGCCCC, and ending after CCAGCTGTATCACTCCGTGC at 101,376,979 bp (GRCm38/mm10). This mutation deletes exon 1 and 415 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null unless there is an alternative ATG that is used. (J:188991)