This allele from project Gpd1l-8296J-M9231 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAAGTCAGAGCCAGCCAA, TTGAGTGGCACCAGGACCTG, GGACTTGTGCGGGCTCCGAA and TATAAGAACAGAGTTTTCAG, which resulted in a 356 bp deletion beginning at Chromosome 9 negative strand position 114,920,771 bp, CGAATGGAAGTGCGAGACTT, and ending after AAGCAACCTTTGGCTGGCTC at 114,920,416 bp (GRCm38/mm10). This mutation deletes exon 2 and 178 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 9 bp deletion (AGTTTTCAG) 48 bp before the 356 bp deletion that will not alter the results of the larger deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 48 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count