Triple mutants were created with exons 2, 14 and 18 targeted. Exon 2 guide RNA target sequence: AGCATACGTCTGTGGATGGC; exon 14 target sequence: CGTATATTCTGGCGGTAGCA; exon 18 target sequence: AACGACATGCTGAGGGAGAT. Seven triple mutants were identified through qPCR. The specific mutations in these strains are not reported. The pound (#) symbol is used for the pool of all seven founders. (J:238422)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count