A 124bp deletion (GRCm39:chr12:72963494-72963618) that includes part of exon 2, intron 2 and part of exon 3 was created by CRISPR/Cas9 genome editing using sgRNAs (targeting CACCGATCTGTTTGTCAGTTTGGAC, AAACGTCCAAACTGACAAACAGATC, CACCGTACTTATGTCTTGCTCATAC and AAACGTATGACAAGACATAAGTAC). Spermatocytes from homozygous mice showed no protein expression by immunofluorescence studies, suggesting that this is a null allele. (J:238491)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count