Nipsnap2^em1(IMPC)J

This allele from project Gbas-8294J-M2404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGCGCCGATTAAACAG, GACTGCCTCTACAACATACG, ATAACTCAAGGGCAGATACG and ATAACTCAAGGGCAGATACG, which resulted in a 365 bp deletion beginning at Chromosome 5 positive strand position 129,744,664 bp, GCTCCCCTGTTTAATCGGCG, and ending after AACTCAAGGGCAGATACGAG at 129,745,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a four bp deletion (GTAT) 68 bp before the 365 bp del that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. (J:188991)