Fdx2^em2Murr

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a G>T Knock-in at Chromosome 9 negative strand position 21073504 (GRCm38/mm10). This mutation changes the G nucleotide to a T at this position and is predicted to cause a change of amino acid sequence at residue 1, mimicking the human p.M1T mutation. (J:188991)