Fdx2^em1Murr

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a 13 bp deletion (ATCATGGCCGCCT) beginning at Chromosome 9 negative strand position 21,073,509 bp, and ending after 21,073,497 bp (GRCm38/mm10). This mutation deletes the start of exon 1 and 3 bp of flanking intronic sequence including the splice acceptor and is predicted to be a null allele. (J:188991)