Rad54l^em2Murr

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a G>T Knockin at Chromosome 4 negative strand position 116,105,767 bp (GRCm38/mm10). This mutation changes the G nucleotide at c.1033G to a T at this position and is predicted to cause a change of amino acid sequence at residue p.G345C, mimicking the human p.G345C mutation. (J:188991)