Rad54l^em1Murr

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a 4 bp deletion (TTCT) at Chromosome 4 negative strand position 116,105,771 bp and ending after 116,105,767 bp(GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 342 and early truncation 18 amino acids later. (J:188991)