This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597 bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289443 (exon 2) and 130 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 182 bp deletion spanning Chr11:121,363,645-121,363,826 before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count