Cgref1^em1(IMPC)J

This allele from project Cgref1-8199J-F4208 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAGTGTGAAGCATCAGA, TTAGAATAAGACCTGACACT, GGAGGACTATGAATACCCAT and GAATGGTTCCACATGCAAGG, which resulted in a 489 bp deletion beginning at Chromosome 5 negative strand position 30,936,119 bp, GTATTCATAGTCCTCCCTGA, and ending after AGAATAAGACCTGACACTGG at 30,935,631 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 31 amino acids later. (J:188991)