Glyctk^em1(IMPC)J

This allele from project Glyctk-8207J-M5437 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGAACTTCCAGCTGAGGAG, GGGGTGCCCCGAGTACCATA, GTAAGAGTCTATGGGCGCAG and GGTCTGGCCTGGTTTCTAAA, which resulted in a 457 bp deletion beginning at Chromosome 9 negative strand position 106,157,473 bp, CGCAGGGGGACGCCCTCTAC, and ending after GGTTGGTCACCTCTCCTCAG at 106,157,017 bp (GRCm38/mm10). This mutation deletes exon 3 and 305 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 114 amino acids later. (J:188991)