This allele from project Rab5b-8208J-M5447 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTCCAAGCACTAAGCCGG, AGCTTCATAGATATTAAGTT, ACCAAGGCCCACCAGCTACA and GTTGTAAGTGGGACAAAGGG, which resulted in a 380 bp deletion beginning at Chromosome 10 negative strand position 128,683,459bp GCTGGTGGGCCTTGGTGGCA, and ending after TATGCTTCCAAGCACTAAGC at 128,683,080 bp (GRCm38/mm10). This mutation deletes exon 3 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 19 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count