Slmap^em1(IMPC)J

This allele from project Slmap-8150J-M2409 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAAGATGAACTTACAGCG, CTATAGTGTCAGGAAGCGCT, TGAGTGGTTTCAGTTGATAG and CGTCTCAAAACTTTTAAAGA, which resulted in a 544 bp deletion beginning at Chromosome 14 negative strand position 26,483,082 bp, GTTTCAGTTGATAGGGGAAA, and ending after TAAGATGAACTTACAGCGTG at 26,482,539 bp (GRCm38/mm10). This mutation deletes exon 3 and 396 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 9 amino acids later. (J:188991)