Greb1l^em1(IMPC)J

This allele from project Greb1l-8129J-M9444 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATTCTGCTGAGTTAAGAGG, ACTGGGCACTAACCACACAG, ACTGGGAATAAGTTACCAAT and GCCTTTACACCATGACTAAA, which resulted in a 512 bp deletion beginning at Chromosome 18 positive strand position 10,521,878 bp, AGTCTGACGTTTCCTCCTCT, and ending after TTGGTGTCTTCCCATTGGTA at 10,522,389 bp (GRCm38/mm10). This mutation deletes exon 16 and 331 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 42 bp insertion at the deletion site as well as a 2 bp (AC) deletion 90 bp before the insertion/deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 727 and early truncation 1 amino acid later. (J:188991)