Rgs19^em1(IMPC)J

This allele from project Rgs19-8147J-M5764 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGCATCATCCTGCCCAG, AATACCCTGACGTCTTCCCA, GGTTATATCTTGAGCCCCAG and GGGCCCAGTGAATTCTAGAG, which resulted in a 500 bp deletion beginning at Chromosome 2 negative strand position 181,691,465 bp, TCCTGGACCCCTGGGGCTCA, and ending after CCTGCCACAGCATCATCCTG at 181,690,966 bp (GRCm38/mm10). This mutation deletes exon 3 and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base (C) insertion at the site of the 500 bp deletion that will have no effect on the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 10 and early truncation 22 amino acids later. (J:188991)