Myo5c^em1(IMPC)J

This allele from project Myo5c-8142J-M5690 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTTTAGCAGAAATACCGA, GTGAGAAGTGCGTCTATGGG, GTGTAAGGAGAACTGCTCGT and GCTCGGGGCACGCAGACGGT, which resulted in a 490 bp deletion beginning at Chromosome 9 positive strand position 75,244,764 bp, CACTAGCAAGCAAACCATCCA, and ending after TCTGTGTAAGGAGAACTGCT at 75,245,253 bp (GRCm38/mm10). This mutation deletes exon 3 and 324 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) inserted 15 bp before the 490bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 5 amino acids later. (J:188991)