Slc26a10^em1(IMPC)J

This allele from project Slc26a10-8158J-F2393 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTGGCAGATATATCGTG, ATTGTGTTGGTCCTTTTCGG, GGTCTTCTAAGAGAGCGGAT and GCAGCAGCCAGGAACCGATG, which resulted in a 444 bp deletion beginning at Chromosome 10 positive strand position 127,178,593 bp, CGATATATCTGCCACTCCGG, and ending after CTGGTGCAGCAGCCAGGAAC at 127,179,036 bp (GRCm38/mm10). This mutation deletes exon 3 and 286 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 144 amino acids later. (J:188991)