Reps2^em1(IMPC)J

This allele from project Reps2-8146J-M5750 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTTTAGCAAGGTTATAGTG, TAGGATTAGATCCTTTCAGC, GTTTTTCCTGTTATGAAATG and AAAATAAAGATGACAAACGC, which resulted in a 616 bp deletion beginning at Chromosome X negative strand position 162,565,597 bp, TTCAAAAGAGGAGGAATAAT, and ending after TCAGCTGGCAGTTAAGGTAG at 162,564,982 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp insertion (AT) before the deletion and a 20 bp deletion (TATTCTTTAGCAAGGTTATA) after the 616 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 78 and early truncation 7 amino acids later. (J:188991)