This allele from project Zc4h2-7995J-F9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG, which resulted in a 381 bp deletion beginning at Chromosome X negative strand position 95,643,567 bp CTGGAGTCTGTCCTATTATC, and ending after GTCAGAATACACGACCTATT at 95,643,187 bp (GRCm38/mm10). This mutation deletes exon 3 and 208 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 2 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count